Although the Mediterranean diet (MD) and the low-fat Therapeutic Lifestyle Changes Diet (TLCD) promote equivalent increases in event-free survival in secondary coronary prevention, possible mechanisms of such complete dietary patterns in these patients, usually medicated, are unclear. The aim of this study was to investigate the effects of the MD versus the TLCD in markers of endothelial function, oxidative stress, and inflammation after acute coronary syndromes. Comparison was made between 3 months of the MD (n = 21; rich in whole grains, vegetables, fruits, nuts, and olive oil, plus red wine) and the TLCD (n = 19; plus phytosterols 2 g/day) in a highly homogenous population of stable patients who experienced coronary events in the previous 2 years (aged 45 to 65 years, all men) allocated to each diet under a strategy designed to optimize adherence, documented as >90%. Baseline demographics, body mass index and clinical data, and use of statins and other drugs were similar between groups. The MD and TLCD promoted similar decreases in body mass index and blood pressure (p ≤0.001) and particularly in plasma asymmetric dimethylarginine levels (p = 0.02) and l -arginine/asymmetric dimethylarginine ratios (p = 0.01). The 2 diets did not further enhance flow-mediated brachial artery dilation compared to baseline (4.4 ± 4.0%). Compared to the TLCD, the MD promoted decreases in blood leukocyte count (p = 0.025) and increases in high-density lipoprotein levels (p = 0.053) and baseline brachial artery diameter. Compared to the MD, the TLCD decreased low-density lipoprotein and oxidized low-density lipoprotein plasma levels, although the ratio of oxidized to total low-density lipoprotein remained unaltered. Glucose, high-sensitivity C-reactive protein, triglycerides, myeloperoxidase, intercellular adhesion molecular, vascular cell adhesion molecule, and glutathione serum and plasma levels remained unchanged with either diet. In conclusion, medicated secondary prevention patients show evident although small responses to the MD and the TLCD, with improved markers of redox homeostasis and metabolic effects potentially related to atheroprotection.
The role of prudent diets for secondary coronary artery disease management remains to be explored. Recent data have shown mortality and morbidity reductions in patients with coronary artery disease managed with adequate diets, exercise, and smoking cessation. However, the mechanisms of diet effects in these patients, who are generally exposed to several drugs, have been only superficially investigated. This includes a lack of information on markers of oxidative stress and inflammation, crucial determinants of endothelial function that are likely relevant also for secondary prevention. Mechanistic information cannot be readily obtained from large-population randomized trials, because diet adherence is not optimized in these cases. The aim of our study was to compare, in medicated patients with coronary artery disease, the effects of aggressive treatment with the Mediterranean diet (MD) to those with the Therapeutic Lifestyle Changes Diet (TLCD), with a focus on endothelial function, inflammation, and oxidative stress.
Methods
We designed a prospective controlled clinical trial to assess 3-month effects of high compliance with the full-pattern MD compared to the TLCD on end point variables, assessed at the beginning and end of interventions. To maximize adherence, diet allocation was not randomized, while selection criteria were stringent to provide a high degree of homogeneity.
Forty-two men aged 45 to 65 years were selected from among consecutive outpatient appointments at our hospital. Eligibility criteria included ≥1 coronary event (myocardial infarction or unstable angina) occurring <24 and >4 months before enrollment, clinical stability and absence of secondary events, body mass index (BMI) 18.5 to 30.0 kg/m 2 , nonsmoker or ex-smoker for >1 year, and fasting blood glucose <110 mg/dl. Exclusion criteria included a history of diabetes, chronic illnesses, or food allergy; serum low-density lipoprotein (LDL) >190 mg/dl; serum triglycerides >310 mg/dl; suspected or confirmed drug or alcohol addiction; and any condition that might impair participation in the study. Special care was taken to continue all medications, with dosages unchanged, during the study; nutritional supplements were not allowed. Exercise levels were kept unchanged. All patients gave written informed consent, and the study was approved by institutional ethics committee.
Without knowledge about specific dietary patterns under investigation, selected patients underwent baseline evaluations including clinical history, nutritional assessment, endothelial function testing, and laboratory measurements. Then, on the basis of previous cultural and dietary habits and 4-day food records, each patient was allocated to either the MD or the TLCD and given personalized dietary advice by a dietitian, together with the patient’s partner. After 3-month interventions, each patient was reevaluated similarly to baseline. Laboratory analyses were conducted at baseline and after the 3-month dietary period.
All patients received cholesterol-lowering dietary advice before the study. During the study, patients were given printed copies of the MD or the TLCD and personalized advice about daily food plans, including portion size models, desired food intake frequency, and specific recipes. Individual food plans were tailored to nutritional assessments, including BMI, energy needs by the Harris-Benedict equation, and daily and cultural habits. Total energy was adjusted only for patients with BMIs >25 kg/m 2 at baseline. The 2 diets were adapted to Brazilian food habits (nutritional patterns are listed in Table 1 ). The advised MD pattern included (1) daily consumption of unrefined cereals and products (e.g., whole-grain bread, pasta, brown rice); fresh fruits (4 to 6 servings/day); varied raw or cooked vegetables and legumes (2 to 3 servings/day); extra-virgin olive oil (30 ml/day) as the main added fat; nonfat or low-fat dairy products (1–2 servings/day) and nuts (10 g/day); (2) weekly consumption of fish (3 to 4 times/week), poultry (3 to 4 times/week), and eggs (0 to 4 per week) and low red meat consumption (once a week). Sweets were allowed only a few times per month; red wine consumption (250 ml/day) was recommended for all MD patients. TLCD patients were advised to follow recommendations according to the National Cholesterol Education Program Third Adult Treatment Panel: decreased fat intake, particularly saturated and trans-fatty acids; increased intake of fruits, vegetables, legumes, whole grains, fat-free and low-fat dairy products; moderate amount of lean meat, fish, or poultry; and vegetable oil for cooking. TLCD patients received a list of soluble fiber-rich foods with daily consumption amounts; all were asked to avoid alcohol during the study. All patients were provided with specific foods that could favor adherence, as follows: for the MD group, mixed plain nuts (Brazil nuts, almonds, and walnuts, 10 g/day), cabernet sauvignon wine (250 ml/day), and extra-virgin olive oil (15 ml, amber flasks); for the TLCD group: cholesterol-lowering spread (phytosterol rich) with a measuring cup (20 g/day). All MD and TLCD patients had similar continuous, individually scheduled and assisted dietitian access throughout the study. Diet composition was analyzed with Food Processor version 10.5 software (Esha Research, Salem, Oregon) adapted to Brazilian food databases.
| Nutrient Goal | MD | TLCD |
|---|---|---|
| Energy | To maintain desirable weight | To maintain desirable weight |
| Protein | 12%–17% of total calories | Approximately 15% of total calories |
| Carbohydrate | 45%–50% of total calories | 55%–60% of total calories |
| Total fat | 33%–38% of total calories | 25%–30% of total calories |
| Monounsaturated fat | 20%–25% of total calories | Up to 20% of total calories |
| Polyunsaturated fat | Up to 10% of total calories | Up to 10% of total calories |
| Saturated fat | ≤8% of total calories | ≤7% of total calories |
| Omega-3 fats | >0.75% of total calories | ⁎ |
| Cholesterol | <200 mg/day | <200 mg/day |
| Dietary fiber | 20–30 g/day | 20–30 g/day |
| Therapeutic lifestyle components of TLCD | ||
| Plant stanols/sterols | ⁎ | 2 g/day |
| Increased viscous fiber | † | 10–15 g/day |
⁎ Value not established by National Cholesterol Education Program Third Adult Treatment Panel (Third report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) final report. Circulation 2002;106:3143–3421).
Compliance with diets and specific foods was enforced through monthly interviews plus 24-hour recall analysis at follow-up visits, unscheduled quarterly 24-hour recalls by telephone and e-mail, patient and partner collaboration, and comparison between baseline and final (3-month) 4-day food-record analyses. At 3 months, adherence scores were also calculated from specific dietary intake questionnaires for the MD and the TLCD. Fatty acid composition analysis by gas chromatography of the extra-virgin olive oil supplied to MD patients showed equivalence with the United States Department of Agriculture nutritional database, and the phytosterol-rich spread had undetectable trans-fatty acids. Anthropometric parameters were obtained by trained technicians using standard methods, and BMI was calculated as weight in kilograms divided by the square of height in meters. Subscapular, triceps, biceps, abdominal, and suprailiac skin-fold thicknesses were measured in alternate triplicates with calipers (Lange, Ann Arbor, Michigan) and expressed as medians.
Plasma and sera from fasting venous blood samples were kept on ice for ≤1 hour and stored at −80°C. Methods were as follows: for oxidized LDL, monoclonal antibody–based immunoassay (Mercodia, Uppsala, Sweden); for soluble vascular cell adhesion molecule–1 and soluble intercellular adhesion molecule–1, enzyme-linked immunosorbent assay (R&D Systems, Minneapolis, Minnesota); for myeloperoxidase, enzyme-linked immunosorbent assay (CardioMPO; PrognostiX, Cleveland, Ohio); and for glutathione, fluorescence assay (Arbor Assays LLC, Ann Arbor, Michigan). Glucose, plasma cholesterol, liver enzymes, triglyceride, high-density lipoprotein cholesterol and calculated LDL cholesterol, lipoprotein(a), apolipoprotein A-I and apolipoprotein B, high-sensitivity C-reactive protein, and total leukocyte count were measured at the hospital laboratory using standard methods. For asymmetric dimethylarginine (ADMA) analysis, plasma samples, shipped to the University of Florida, were loaded onto an Oasis SPX cation exchange column (Millipore, Billerica, Massachusetts) and basic amino acids eluted with 1 ml sodium hydroxide/methanol/water in a 10:40:50 ratio. Samples were dried, resuspended in mobile phase, derivatized with o-phtalaldehyde and assessed by high-performance liquid chromatography and electrochemical detection. Mitochondrial deoxyribonucleic acid (DNA) copy number was assessed in peripheral blood mononuclear cells by SYBR Green quantitative polymerase chain reaction (Applied Biosystems, Carlsbad, California), with single-copy gene hemoglobin-β as reference. Primer (400 to 600 nmol/L) sequences were (5′-3′): mitochondrial DNA–F: CCTAGCCGTTTACTCAATCCT; R: TGATGGCTAGGGTGACTTCAT; hemoglobin-β–F: GTGAAGGCTCATGGCAAGA; and R: AGCTCACTCAGGTGTGGCAAAG. Conditions were: 40 cycles at 95°C for 15 seconds and 60°C for 1 minute.
Endothelium-dependent FMD and responses to sublingual isosorbide dinitrate 5 mg were assessed as described under current guidelines. Brachial artery diameters were assessed in the left arm in recumbent position, after 10-minute rest in a room kept at 20°C to 25°C, using a 7.5-MHz linear-array vascular ultrasound transducer and an Apogee 800 Plus ultrasound system (ATL Ultrasound, Bothell, Washington). Blood pressure and heart rate were monitored with an automated sphygmomanometer. Vessel diameter was measured with locally developed software. Reactive hyperemia was induced by the inflation of a tourniquet around the forearm to 250 mm Hg, deflated after 5 minutes. Endothelium-dependent and independent dilation were calculated as the percentage change in brachial artery diameter ratio after reactive hyperemia or nitrate to baseline diameter. All tests were blindly performed and analyzed by a single dedicated ultrasonographer.
A sample size of 40 patients was calculated to detect a 10% difference in total cholesterol (because this is a well-established variable), with a 24 mg/dl SD (determined from preliminary data), 5% type I error, and 10% type II error. Such a sample size is consistent with the recommendations of the International Brachial Artery Reactivity Task Force for endothelial function studies. Results reflect data from 40 patients who completed the study; results including the 2 dropouts were similar. Continuous variables are presented as mean ± SD. Baseline characteristics were compared between groups using Student’s t or chi-square tests. Two-factor repeated-measures analysis of variance was used to compare changes between groups (MD vs TLCD) and between time periods (baseline vs 3 months). Analysis of mitochondrial DNA copy number, including a normal control group, was performed using Kruskal-Wallis and Dunnet’s post hoc tests. Statistical analysis was carried out using SPSS version 15.0 (SPSS, Inc., Chicago, Illinois). All tests were 2 tailed, and the significance level was p <0.05.
Results
From 176,000 consecutive records screened over 31 months, 159 patients were interviewed, and 42 were eligible and assigned to the MD (n = 21) or the TLCD (n = 21); 2 TLCD patients dropped out because of family problems, so that 40 (95%) completed the study. Table 2 lists the results of all analyzed variables. At baseline, MD patients had higher weights and heights but similar BMIs compared to TLCD patients. Age, body composition, blood pressure, glucose levels, and oxidative, inflammatory, and endothelial function variables were similar between MD and TLCD patients, with the exception of higher oxidized LDL levels in TLCD patients. Histories of dyslipidemia and/or hypertension were present in >90% patients, myocardial infarction in 52%, percutaneous intervention in >68%, and surgical revascularization in 33%. None of these variables differed between groups. Eighty-six percent to 100% of patients were taking lipid-lowering, antihypertensive, and antiplatelet agents. Sedentary lifestyles were reported by 35% and weekly aerobic physical activity ≥90 minutes by 53% of patients, with exercise status maintained during the 3-month intervention in 97.5% of patients (data not shown). Baseline nutritional characteristics were similar between the groups, except for monounsaturated fats, which were higher in MD than in TLCD patients ( Table 3 ). Food-record analysis before and after the intervention showed total energy reduction (p <0.001) with the MD (464 kcal) and the TLCD (478 kcal). The TLCD significantly decreased total fat (38%) compared to the MD and to baseline, while the MD significantly decreased carbohydrates compared to the TLCD and to baseline. The MD increased monounsaturated fat from 9% to 15% kcal, while total fat increased by only 1%. Saturated fats decreased and omega-3 fatty acids reached 0.9% in the 2 groups. There were 199 attendances to 200 scheduled appointments (5 per patient). Additional quarterly interviews by telephone (80%) or e-mail (20%) were well accepted. Validated adherence scores (highest MD adherence = 9) showed values of 7, 8, and 9, respectively, in 19%, 33%, and 48% of MD patients. Reasons for scores of 7 and 8 were fish intake <3 times/week and/or lower compliance with whole-grain cereals. The MEDFICTS questionnaire indicated high TLCD adherence, with scores <40 for all patients. Questionnaires and 24-hour records showed high adherence to whole diet patterns as well as specific foods: extra-virgin olive oil, wine, and nuts with the MD and phytosterol-rich spread with the TLCD.
| Variable | MD (n = 21) | TLCD (n = 19) | p Value Baseline ⁎ | p Value Between Groups ¶ | ||||
|---|---|---|---|---|---|---|---|---|
| Baseline | 3 Months | Baseline | 3 Months | Time | Group | Time × Group | ||
| Age (years) | 55.0 ± 4.6 | NA | 54.6 ± 5.0 | NA | 0.807 | NA | NA | NA |
| Height (cm) | 173 ± 5 | NA | 167 ± 5 | NA | 0.001 | NA | NA | NA |
| Smoking status | ||||||||
| Ex-smoker for ≥1 year | 17 (81%) | NA | 10 (53%) | NA | 0.091 | NA | NA | NA |
| Educational level | ||||||||
| High school or beyond | 21 (100%) | NA | 16 (84%) | NA | 0.058 | NA | NA | NA |
| Medication | ||||||||
| Aspirin | 20 (95%) | NA | 17 (90%) | NA | 0.489 | NA | NA | NA |
| Other antiplatelet drugs | 8 (38%) | NA | 9 (47%) | NA | 0.554 | NA | NA | NA |
| Statins | 17 (81%) | NA | 16 (84%) | NA | 0.787 | NA | NA | NA |
| Statins plus ezetimibe | 4 (19%) | NA | 3 (16%) | NA | 0.787 | NA | NA | NA |
| Nitrates | 4 (19%) | NA | 3 (16%) | NA | 0.787 | NA | NA | NA |
| ACE inhibitors | 11 (52%) | NA | 13 (68%) | NA | 0.301 | NA | NA | NA |
| β blockers | 18 (86%) | NA | 19 (100%) | NA | 0.087 | NA | NA | NA |
| Body weight (kg) | 79.3 ± 7.5 | 77.7 ± 7.5 | 73.6 ± 7.6 | 71.9 ± 6.7 | 0.023 | <0.001 | 0.017 | 0.879 |
| BMI (kg/m 2 ) | 26.5 ± 1.9 | 25.9 ± 1.8 | 26.3 ± 2.5 | 25.7 ± 2.4 | 0.827 | <0.001 | 0.783 | 0.819 |
| Waist circumference (cm) | 96 ± 6 | 94 ± 6 | 94 ± 8 | 92 ± 8 | 0.400 | <0.001 | 0.352 | 0.885 |
| Waist/hip ratio | 0.94 ± 0.05 | 0.94 ± 0.04 | 0.95 ± 0.07 | 0.94 ± 0.06 | 0.801 | 0.211 | 0.939 | 0.372 |
| Skin-fold thickness sum (mm) | 102 ± 18 | 99 ± 14 | 94 ± 25 | 88 ± 24 | 0.205 | 0.004 | 0.117 | 0.357 |
| Systolic blood pressure (mm Hg) | 138 ± 13 | 127 ± 11 | 134 ± 19 | 128 ± 13 | 0.479 | 0.001 | 0.791 | 0.246 |
| Diastolic blood pressure (mm Hg) | 87 ± 7 | 80 ± 7 | 87 ± 9 | 81 ± 8 | 0.971 | <0.001 | 0.731 | 0.637 |
| Total cholesterol (mg/dl) | 153 ± 33 | 155 ± 35 | 161 ± 24 | 147 ± 32 | 0.396 | 0.114 | 0.998 | 0.029 |
| LDL cholesterol (mg/dl) | 87 ± 26 | 90 ± 30 | 98 ± 23 | 86 ± 27 | 0.140 | 0.236 | 0.598 | 0.034 |
| HDL cholesterol (mg/dl) | 40 ± 7 | 43 ± 9 | 38 ± 7 | 38 ± 7 | 0.400 | 0.076 | 0.133 | 0.053 |
| Oxidized LDL (U/L) | 60 ± 21 | 59 ± 20 | 78 ± 24 | 62 ± 21 | 0.019 | 0.002 | 0.114 | 0.009 |
| Oxidized LDL/total LDL | 0.73 ± 0.25 | 0.67 ± 0.16 | 0.79 ± 0.23 | 0.73 ± 0.26 | 0.384 | 0.120 | 0.297 | 0.976 |
| Triglycerides (mg/dl) | 130 ± 74 | 110 ± 62 | 121 ± 59 | 112 ± 70 | 0.694 | 0.086 | 0.870 | 0.524 |
| Apolipoprotein B (g/L) † | 0.79 ± 0.16 | 0.78 ± 0.19 | 0.91 ± 0.24 | 0.80 ± 0.24 | 0.066 | 0.027 | 0.268 | 0.067 |
| Apolipoprotein A-I (g/L) † | 1.49 ± 0.22 | 1.48 ± 0.31 | 1.37 ± 0.21 | 1.28 ± 0.21 | 0.063 | 0.206 | 0.019 | 0.357 |
| Lipoprotein(a) (mg/dl) | 37 ± 29 | 40 ± 32 | 36 ± 28 | 38 ± 29 | 0.844 | 0.093 | 0.859 | 0.934 |
| Glucose (mg/dl) | 91 ± 8 | 93 ± 8 | 89 ± 8 | 88 ± 9 | 0.419 | 0.348 | 0.138 | 0.251 |
| High-sensitivity C-reactive protein (mg/L) | 1.65 ± 1.50 | 1.07 ± 0.93 | 1.38 ± 1.07 | 2.07 ± 2.99 | 0.510 | 0.874 | 0.437 | 0.058 |
| Total leukocyte count (×10 3 /mm 3 ) | 6.3 ± 1.2 | 5.8 ± 1.2 | 6.1 ± 1.3 | 6.2 ± 1.5 | 0.495 | 0.176 | 0.888 | 0.025 |
| Myeloperoxidase (pmol/l) ‡ | 433 ± 86 | 376 ± 136 | 389 ± 79 | 384 ± 69 | 0.243 | 0.150 | 0.637 | 0.215 |
| Soluble intercellular adhesion molecule–1 (ng/ml) | 124 ± 29 | 122 ± 35 | 138 ± 35 | 127 ± 38 | 0.177 | 0.068 | 0.372 | 0.201 |
| Soluble vascular cell adhesion molecule–1 (ng/ml) | 314 ± 74 | 320 ± 84 | 317 ± 68 | 317 ± 75 | 0.891 | 0.645 | 0.995 | 0.637 |
| l -arginine (μmol/L) § | 94.9 ± 11.4 | 91.5 ± 16.1 | 86.1 ± 20.2 | 85.5 ± 18.8 | 0.110 | 0.378 | 0.143 | 0.549 |
| ADMA (μmol/L) § | 0.88 ± 0.22 | 0.77 ± 0.22 | 0.90 ± 0.22 | 0.82 ± 0.24 | 0.794 | 0.021 | 0.575 | 0.685 |
| l -arginine/ADMA § | 114.7 ± 32.2 | 125.1 ± 27.4 | 99.3 ± 25.8 | 111.8 ± 35.9 | 0.108 | 0.012 | 0.110 | 0.805 |
| Plasma reduced (GSH)/oxidized (GSSG) glutathione | 1.3 ± 0.7 | 1.3 ± 0.7 | 1.5 ± 0.9 | 1.4 ± 0.6 | 0.487 | 0.301 | 0.503 | 0.678 |
| Erythrocyte GSH/GSSG § | 5.5 ± 6.4 | 5.8 ± 5.0 | 5.8 ± 6.5 | 5.8 ± 3.5 | 0.881 | 0.921 | 0.916 | 0.885 |
| Mitochondrial DNA copy number ∥ | ||||||||
| 2 -DDCT (controls) | 10.4 ± 10.1 | 8.6 ± 5.0 | 6.7 ± 3.3 | 10.3 ± 11.5 | 0.161 | 0.635 | 0.640 | 0.154 |
| DCT (MctHBb-MctDNAmit) | 7.5 ± 1.0 | 7.4 ± 0.7 | 7.1 ± 0.6 | 7.4 ± 1.0 | 0.185 | 0.528 | 0.447 | 0.270 |
| Endothelial function † | ||||||||
| Endothelium-dependent flow-mediated dilation (%) | 4.4 ± 3.6 | 4.9 ± 4.3 | 4.4 ± 5.5 | 4.9 ± 3.7 | 0.999 | 0.397 | 0.790 | 0.760 |
| Endothelium-independent postnitroglycerin dilation (%) | 23.1 ± 6.6 | 18.7 ± 8.7 | 19.2 ± 8.1 | 20.8 ± 8.8 | 0.099 | 0.238 | 0.785 | 0.082 |
| Baseline brachial artery diameter (mm) | 4.38 ± 0.39 | 4.44 ± 0.52 | 4.44 ± 0.51 | 4.34 ± 0.49 | 0.690 | 0.413 | 0.983 | 0.035 |
| Baseline flow velocity (cm/s) | 51 ± 10 | 54 ± 11 | 52 ± 14 | 56 ± 14 | 0.759 | 0.046 | 0.636 | 0.755 |
| Hyperemic flow velocity (cm/s) | 96 ± 20 | 99 ± 19 | 95 ± 21 | 88 ± 14 | 0.793 | 0.648 | 0.174 | 0.220 |
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
