Changes in the cytocompatibility, surface hardness, and surface topography of 3-dimensional–printed clear aligners after clinical use

Introduction

This study evaluated how clinical use affects the surface properties and cytocompatibility of 3-dimensional (3D)–printed clear aligners by comparing them against saliva-unexposed and artificial saliva–exposed groups.

Methods

Eleven aligners were collected from 5 adult patients after 10 days of use (clinically used group). Two additional groups were established: the saliva-unexposed group (immediately after postprocessing) and the artificial saliva–exposed group (immersed in artificial saliva). All aligners underwent extraction for 1 day (day-1 extraction) and an additional 6 days (day-7 extraction). After 7 days of extraction, surface properties, including hardness (Shore D) and topography (scanning electron microscope imaging), were analyzed. Cytotoxicity to normal L929 cells was evaluated using 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assays. Proinflammatory responses in lipopolysaccharide (LPS)–induced presensitized L929 cells were assessed by quantitative polymerase chain reaction, measuring interleukin-6, tumor necrosis factor–α, and nitric oxide synthase 2 expression levels.

Results

Shore D hardness did not differ among groups. Scanning electron microscope imaging revealed increased surface irregularities after salivary exposure. All groups exhibited no cytotoxicity (>70% viability) in both day-1 and day-7 extractions, with the clinically used group showing significantly higher cell viability than the saliva-unexposed group in both extractions ( P <0.001). However, when LPS-induced presensitized cells were treated with day-7 extraction, only the clinically used group showed a significant increase in both interleukin-6 and tumor necrosis factor–α expression compared with LPS-only–treated cells ( P <0.001).

Conclusions

Saliva-exposed 3D-printed aligners exhibited increased surface irregularities and lower cytotoxicity compared with unexposed aligners. However, clinically used 3D-printed aligners may exacerbate proinflammatory responses in presensitized cells. Depending on the initial state of the cells, cytological responses to 3D-printed aligners may vary.

Graphical abstract

Highlights

  • Salivary exposure increases surface irregularities of 3D-printed clear aligners.

  • The 3D-printed aligners were noncytotoxic; salivary exposure increased cell viability.

  • Clinically used 3D-printed aligners may increase inflammation in sensitized cells.

  • Cellular responses to 3D-printed aligners may vary with baseline state.

The increasing demand for esthetic orthodontic appliances has established clear aligners as a pivotal component of contemporary orthodontic treatment. Clear aligners offer both esthetic appeal and convenience. They have demonstrated sufficient clinical effectiveness to serve as an alternative to traditional fixed orthodontic appliances in patients with mild-to-moderate malocclusion. ,

In recent years, 3-dimensional (3D) printing technology has further developed the production of clear aligners by minimizing mechanical and dimensional distortions commonly associated with conventional thermoforming techniques, thus enhancing the fit and accuracy. Moreover, the development of photopolymerizable polyester–urethane polymer has made in-office direct printing of clear aligners possible. Previous studies have demonstrated that this polymer allows the application of light continuous forces on the teeth, geometric stability, shape memory, and adequate biocompatibility. ,

Clear aligners undergo changes in their chemical and mechanical properties during clinical use, driven by environmental factors (saliva, enzymes, and temperature-humidity fluctuations) and mechanical factors (mastication and occlusal loading). , Notably, 3D-printed aligners have been suggested to be more susceptible to secondary reactions, such as hydrolytic degradation, than conventional thermoformed aligners. , Given this potential vulnerability, research into their interactions with saliva is warranted.

Previous studies have examined the effects of salivary exposure on the mechanical properties and color stability of 3D-printed aligners. ,, Typically, resin exhibits compromised structural integrity after exposure to saliva because of hydrolytic changes, which can modify surface properties, such as roughness, porosity, microcrack formation, and surface hardness. , Among these, changes in surface hardness are particularly relevant, as reduced hardness may lower wear resistance and increase the risk of surface damage, thereby promoting bacterial adhesion and potentially affecting the surrounding cellular microenvironment. , However, although previous studies have focused on the impact of 3D printing parameters on cytotoxicity, cytological responses to saliva-induced changes in 3D-printed aligners remain unclear. ,,

Inadvertent oral exposure to resin constituents can negatively impact cells and induce an inflammatory response. However, conventional cytotoxicity studies have primarily focused on normal cells, without considering their initial state. Clinically, maintaining oral hygiene can be challenging, particularly in patients with malocclusion, in which conditions, such as marginal gingivitis, may develop. Even when orthodontic treatment begins under clinically inflammation-free conditions, patients seeking clear aligner therapy often belong to an older age group, in which age-related factors, such as thinning of the oral mucosa, reduced attachment, and immune senescence, might further increase their susceptibility to inflammation. ,,, Therefore, a cytocompatibility assessment that accounts for the initial inflammatory-prone condition is needed to better reflect real clinical situations.

Given these clinical considerations, this study aimed to evaluate changes in surface properties and cytocompatibility of 3D-printed clear aligners after clinical use. The first objective was to assess changes in surface hardness, surface topography, and cytotoxicity to normal cells after salivary exposure and clinical use. The second objective was to determine whether clinical use could influence proinflammatory responses of presensitized cells.

Material and methods

The study protocol was reviewed and approved by the institutional review board of Yonsei University Dental Hospital (CRNo: 2-2024-0044). A total of 22 clinically used 3D-printed clear aligners (Graphy, Seoul, Republic of Korea) were previously collected from adult patients (>19 years) who visited the Department of Orthodontics at Yonsei University Dental Hospital between September 2023 and March 2024, with written informed consent, and were deposited in the Biobank of Yonsei University Dental Hospital, a member of the Korea Biobank Network (project No.2024ER050700). Wear duration and metadata were reviewed for all 22 banked aligners. To maximize the number of eligible aligners while maintaining within-group homogeneity, we selected the most common wear duration, 10 days. Consequently, 11 aligners (6 maxillary aligners and 5 mandibular aligners) from 5 patients (3 females and 2 males) with a 10-day wear duration were included and designated as the clinically used group.

Using scanned files corresponding to these 11 aligners, 2 additional sets of clear aligners were printed and further divided into 2 groups as follows: (1) saliva-unexposed group: clear aligners collected immediately after printing and postprocessing (without any exposure to saliva), and (2) artificial saliva–exposed group: clear aligners aged in artificial saliva (TMABIO artificial saliva with mucin E2721-16 [TB0921], T&M Bioscience, Suwon, Republic of Korea) at 37°C for 20 h/d for a total of 10 days. After clinical practice guidelines recommended 20 hours of daily wear, aligners were cleaned with filtered water and stored in cases at room temperature for 4 hours. Overall group descriptions are summarized in Table I .

Table I

Experimental group descriptions

Group name Description
Saliva-unexposed group Aligners were not exposed to any kind of saliva (immediately after 3D printing and postprocessing).
Artificial saliva–exposed group Aligners were aged in artificial saliva at 37°C for 10 d (20 h/d).
Clinically used group Aligners were worn by patients in real-life settings for 10 d (instructed to wear 20 h/d).

All clear aligners were fabricated using the same protocol. Clear aligners were designed using aligner-specific software (Direct Aligner Designer, Graphy), following the manufacturer’s guidelines. The aligner shell was oriented at a consistent angle under standardized conditions before exporting stereolithography files. These stereolithography files were then 3D-printed using light-emitting diode technology (NBEE, Uniz, San Diego, Calif) and TC-85DAC resin (TeraHarz, Graphy), with a layer thickness of 50 μm. After printing, any excess resin was removed using a centrifuge (TeraHarz spinner, Graphy) for 5 minutes. Postcuring was conducted for 20 minutes, with the support left intact, under nitrogen and ultraviolet light (385-405 nm) in a postcuring machine (TeraHerz cure, Graphy). Finally, aligners were submerged in boiling water at 100°C for 1 minute and then dried.

The overall extraction process was performed following International Standards Organization (ISO) 10993-12:2021. Only the section of the device corresponding to the right first premolar to the first molar, with a weight ranging 390-450 mg, was cut and used. Afterward, each group was extracted in a growth medium at an extraction ratio of 100 mg/mL for 24 hours at 37°C. High-density polyethylene film (Hatano Research Institute, Kanagawa, Japan) was used as a negative control, and natural rubber latex was used as a positive control. Negative and positive controls were extracted in growth medium at an extraction ratio of 3 cm 2/mL. After the first day of extraction, the extraction products were collected and designated as day-1 extraction, whereas those obtained after an additional 6 days of extraction were designated as day-7 extraction.

After completing the 7-day extraction process, 6 samples per group were selected, and 2 mm × 2 mm specimens were prepared from the buccal surface of the molar region in all groups. In addition, to assess the effect of extraction itself, additional specimens were prepared in the saliva-unexposed group from an unprocessed area that had not undergone the previously mentioned preparation for extraction. Then, Shore D hardness was measured with a Shore durometer (SAUTER HAD 100-1, Kern & Sohn GmbH, Balingen, Germany). The hardness of each sample in the saliva-unexposed group before extraction was also measured to evaluate the effect of extraction itself. Each specimen was measured 5 times at the same location, and the mean value was recorded.

After completing the 7-day extraction process, the buccal surfaces of the maxillary right first molar (number 16) and the mandibular right first premolar (number 44) from extracted samples were selected as representative specimens. Similar to the surface hardness grouping, areas without extraction in the saliva-unexposed group were also selected as specimens to assess the effect of extraction itself. The surface topography of each specimen was observed at 30× and 100× magnifications using a scanning electron microscope (SEM, S-3000N, Hitachi High Technologies, Japan).

L929 mouse fibroblasts were purchased from American Type Culture Collection (Manassas, Va). L929 cells were cultured in high-glucose Dulbecco’s modified Eagle medium (Cytiva, Marlborough, Mass) supplemented with fetal bovine serum (Thermo Fisher Scientific, Waltham, Mass) and 1% penicillin-streptomycin (Cytiva) at 37°C with 5% carbon dioxide (CO 2 ) and 95% humidity. The growth medium was refreshed every 2 to 3 days. Subculturing was performed through trypsinization.

L929 cells were seeded into 96-well cell culture plates (Cellstar, Greiner Bio-One, Kremsmünster, Austria) at a density of 1 × 10 4 cells and incubated at 37°C with 5% CO 2 for 24 hours. After the old growth medium was discarded, day-1 or day-7 extractions were added to each well and incubated for 24 hours. After that, the extraction was removed and replaced with 50 μL of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) (Sigma Aldrich, Saint Louis, Mo) at a concentration of 1 mg/mL at 37°C with 5% CO 2 for 2 hours. Afterward, the MTT solution was removed, and 100 μL of isopropanol was added to each well. Finally, absorbance at 570 nm was measured using a microplate reader (Epoch, Biotek, Winooski, Vt). The optical density (OD) was calculated with the following equation:

Cell viability = OD of experimental group – OD of blank control OD of negative control – OD of blank control × 100 ( % )

To assess the proinflammatory response in an in vitro assay, quantitative polymerase chain reaction (qPCR) was performed. L929 cells were seeded into 12-well plates at a density of 5 × 10 4 cells per well. After a 1-day incubation, the medium was removed and the wells were rinsed with modified Dulbecco’s phosphate–buffered saline (Cytiva). After lipopolysaccharide (E coli LPS; 100 ng/mL, Sigma-Aldrich) was added to each well, the plates were incubated for 24 hours. Afterward, 2 wells were grouped, and an appropriate medium was applied for 1 day as follows: LPS-only–treated group (untreated with extraction), Dulbecco’s modified Eagle medium; other groups, each group’s day-7 extraction. Total RNA was extracted using Qiazol lysis reagent (Qiagen, Hilden, Germany). RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). Complementary DNA was then synthesized using RNA and a PrimeScript RT reagent kit (Takara, Tokyo, Japan) according to the manufacturer’s instructions. qPCR was performed on a real-time PCR system using TB Green Premix Ex Taq II (Takara), according to the manufacturer’s instructions, to investigate the expression of proinflammatory response genes (interleukin-6 [IL-6], tumor necrosis factor–alpha [TNF-α], and nitric oxide synthase 2). Target gene primers were purchased from Bioneer (Daejeon, Republic of Korea). Their sequences are listed in Table II . Glyceraldehyde-3–phosphate dehydrogenase was used as the housekeeping gene.

Table II

Primer sequences used for qPCR gene expression assays

Molecules Primer sequence (5’→3’)
IL-6 Forward: TCTTGGGACTGATGCTGGTG
Reverse: TTGCCATTGCACAACTCTTTTC
TNF-α Forward: TGTAGCCCACGTCGTAGCAAA
Reverse: TGTGGGTGAGGAGCACGTA
nitric oxide synthase 2 Forward: GGTGAAGGGACTGAGCTGTT
Reverse: ACGTTCTCCGTTCTCTTGCAG
Glyceraldehyde 3–phosphate dehydrogenase Forward: CCCACTCTTCCACCTTCGATG
Reverse: CGAGTTGGGATAGGGCCTCT

Statistical analysis

All statistical analyses were performed using SPSS (version 27.0; IBM Korea, Seoul, Republic of Korea). Shore D hardness and cell viability data were analyzed using one-way analysis of variance (ANOVA), followed by the Tukey honest significant difference test at a 95% confidence level. qPCR data were analyzed using a paired t test with the same confidence level.

Results

Mean Shore D hardness value was 70.72 ± 1.96 for the saliva-unexposed group without extraction, 69.75 ± 3.29 for the saliva-unexposed group, 68.82 ± 3.83 for the artificial saliva–exposed group, and 67.73 ± 2.66 for the clinically used group, showing no significant differences among groups ( Fig 1 ).

Fig 1

Shore D hardness values of different groups. Hardness was measured after 7 days of extraction for the experimental groups described in Table I . Additional measurements were performed for the saliva-unexposed group before extraction to assess the effect of the extraction process itself. Statistical significance was determined using one-way ANOVA. ns , no statistically significant difference.

SEM imaging at 30× magnification showed that all groups exhibited an uneven surface characterized by multiple circular bulges ( Fig 2 ). Notably, saliva-exposed groups (artificial saliva–exposed group and clinically used group) exhibited a remarkable increase in surface irregularities. At 100× magnification, circular bulges appeared more defined and interconnected in saliva-exposed groups, forming a striated pattern, than in the saliva-unexposed group. The clinically used group exhibited greater height variation within individual images than other groups ( Fig 3 , number 44).

Jun 27, 2026 | Posted by in CARDIOLOGY | Comments Off on Changes in the cytocompatibility, surface hardness, and surface topography of 3-dimensional–printed clear aligners after clinical use

Full access? Get Clinical Tree

Get Clinical Tree app for offline access